| Home | E-Submission | Sitemap | Contact Us |  
top_img
Algae > Volume 33(1); 2018 > Article
Hwang, Kim, Hwang, Park, Ha, and Lee: Intraspecific variation of gene structure in the mitochondrial large subunit ribosomal RNA and cytochrome c oxidase subunit 1 of Pyropia yezoensis (Bangiales, Rhodophyta)

ABSTRACT

Red algal mitochondrial genomes (mtDNAs) can provide useful information on species identification. mtDNAs of Pyropia / Porphyra (Bangiales, Rhodophyta) have shown diverse variation in their size and gene structure. In particular, the introns and intronic open reading frames found in the ribosomal RNA large subunit gene (rnl) and cytochrome c oxidase subunit 1 gene (cox1) significantly vary the mitochondrial genome size in Pyropia / Porphyra species. In this study, we examined the exon / intron structure of rnl and cox1 genes of Pyropia yezoensis at the intraspecific level. The combined data of rnl and cox1 genes exhibited 12 genotypes for 40 P. yezoensis strains, based on the existence of introns. These genotypes were more effective to identify P. yezoensis strains in comparison to the traditional DNA barcode cox1 marker (5 haplotypes). Therefore, the variation in gene structure of rnl and cox1 can be a novel molecular marker to discriminate the strains of Pyropia species.

INTRODUCTION

Pyropia species is one of the major seaweeds cultivated in Korea, Japan, and China (Niwa et al. 2004, Hwang et al. 2014). Strain identification at the intraspecific level of Pyropia yezoensis (Ueda) M. S. Hwang & H. G. Choi is important to the Pyropia aquaculture industry for the maintenance of aquaculture strains and for the development of new cultivars. Although various molecular markers have been developed to discriminate P. yezoensis at the inter / intraspecific levels (Niwa et al. 2004, 2005, Hwang et al. 2005, Park et al. 2008, Niwa and Kobiyama 2009), more efficient tools for precise discrimination are still required.
Red algal mitochondrial genomes (mtDNAs) have interesting genes and structural composition (Odintsova and Yurina 2002, Smith et al. 2012, Yang et al. 2015). Such genetic features have provided useful information for interpreting the evolutionary history of Bangiophycean species (Smith et al. 2012). Particularly, the gene composition and structural variations of mtDNAs of Pyropia species have provided useful genetic information at the inter / intraspecific levels (Hwang et al. 2013, 2014, Hughey et al. 2014).
The study of mtDNAs in Pyropia / Porphyra (Bangiales, Rhodophyta) showed that they exhibit diverse variation in genome size and genetic structure, and also that they contain higher number of introns and intronic open reading frames (ORFs) in comparison to other red algae (Hughey et al. 2014, Hwang et al. 2014, Yang et al. 2015). Specifically, structural variation in the exon / intron structure of the large subunit ribosomal RNA gene (rnl) and cytochrome c oxidase subunit 1 gene (cox1) was reported in Pyropia / Porphyra species (Hwang et al. 2013, 2014, Hughey et al. 2014). These genetic variations significantly affected the size of mitochondrial genome of Pyropia / Porphyra species (Hwang et al. 2013, 2014, Hughey et al. 2014); a similar phenomenon was observed in the brown alga, Pylaiella littoralis (Ikuta et al. 2008).
Hwang et al. (2013, 2014) and Kong et al. (2014) examined the complete genome of mtDNA of P. tenera and P. yezoensis, and explored the genetic variation of exon / intron structure and the phylogenetic relationship among the intronic ORFs. Hughey et al. (2014) also reported the presence of intronic ORFs and the size variations of mtDNA of P. perforata. In this study, we examined the exon / intron structure of rnl and cox1 of P. yezoensis at the intraspecific level. The presence / absence of intron patterns were examined among the different strains of P. yezoensis.

MATERIALS AND METHODS

We analyzed 40 strains of P. yezoensis deposited in the Seaweed Research Center (National Institute of Fisheries Science, Mokpo, Korea) (Table 1). Blades of 27 P. yezoensis strains were collected from Korean coastal regions or aquaculture farms, and the conchocelis filaments were induced and cultured in the Provasoli enrichment medium (Provasoli 1968) at 20°C under white fluorescent irradiation of 20 μmol photon m−2 s−1 (14 L : 10 D cycle). Thirteen Japanese P. yezoensis strains were also analyzed (Table 1). The conchocelis filaments were used for the molecular analyses. Total genomic DNA was extracted using a DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions with an extension of incubation time by one hour.
To reveal the exon / intron structure of rnl and cox1 regions of P. yezoensis, we designed new primer sets having the binding sites on each exon region. These exon-primed intron-crossing (EPIC) markers showed high efficiency in revealing the exon / intron structure (Palumbi and Baker 1994, Bierne et al. 2000). Three and four primer sets were developed to reveal the genetic structure of rnl and cox1 regions, respectively (Tables 2 & 3, Fig. 1).
The mtDNAs of P. tenera (Kjellm.) N. Kikuchi, M. Miyata, M. S. Hwang & H. G. Choi (NC_021475, Hwang et al. 2013) and P. yezoensis (NC_017837, Kong et al. 2014; KF561997, Hwang et al. 2014) were used as reference sequences for the primer design. We performed long range polymerase chain reaction (LPCR) to amplify the exon / intron structure of rnl and cox1 genes (Hwang et al. 2013). LPCR was carried out in a 20 μL volume containing 10–50 ng of total genomic DNA, utilizing the LA Taq polymerase system (TaKaRa Bio, Shiga, Japan). The amplification conditions were as follows: 2 min at 94°C, followed by 30 cycles at 94°C for 10 s, 60°C for 30 s, and at 68°C for 5 min, with a final extension at 68°C for 7 min. Band patterns of LPCR products were analyzed by agarose gel electrophoresis.
We also determined the sequences of the cox1 in 40 P. yezoensis strains, which has been used as the standard target DNA region for DNA barcoding of red algae (Saunders 2005). To amplify the cox1 region, we designed a new primer, cox1e1R16F (5′-TGCCAAGACAGGTACTGCT-3′) having the binding position from 30738 to 30756 in P. yezoensis (NC_017837), located at the 5′ end of cox1 gene. The primer pair, cox1e1R16F (this study) and cox1e1Fpy1R (Hwang et al. 2013), was used for the amplification and sequencing of cox1 region in P. yezoensis samples. The amplification conditions were as follows: 3 min at 95°C, followed by 40 cycles at 94°C for 30 s, 50°C for 30 s, and 72°C for 1 min, with a final extension at 72°C for 7 min. PCR products were sequenced commerically (Genotech, Daejeon, Korea) and the sequences were assembled in Sequencher 5.4.6 (Gene Codes Corporation, Ann Arbor, MI, USA). Pairwise distances were calculated using the MEGA 6.0 program (Tamura et al. 2013).

RESULTS

PCR amplification of cox1 gene generated a 549 bp in all 40 samples, excluding the primer binding sites. Analysis of cox1 sequences revealed 4 haplotypes among the 27 Korean P. yezoensis strains (C1–C4) (Table 1). On the other hand, 13 strains of Japanese P. yezoensis shared the same haplotype (C5). The pairwise distance among the haplotypes ranged from 0.2 to 0.9% (1–5 bp).
We found four exons and three introns in the rnl in all of the sampled P. yezoensis strains, also reported in previous studies (Hwang et al. 2013, 2014); and five exons and four introns were revealed in the cox1 (Fig. 1). The results revealed five genotypes (R111, R110, R101, R011, and R010) in the rnl intron and six genotypes (C1101, C0111, C0101, C0100, C0001, and C0000) in the cox1 intron based on the existence of introns (Tables 1 & 3). Combined structural variations of rnl and cox1 exhibited 12 genotypes among the 40 P. yezoensis strains (Table 1). Korean P. yezoensis exhibited 12 genotypes (H1–H12) among 27 strains. The genotype 5 (H5) was dominant, and broadly distributed in nine Korean strains. All of the Japanese P. yezoensis strains had the same gene structure (H12) (Table 1).

DISCUSSION

The presence of introns and intronic ORFs is the main reason for variation in the size of the mitochondrial genome of Pyropia species. Hwang et al. (2013, 2014) was the first to report this intron structure from P. tenera and P. yezoensis in red algae. In this study, we examined the genetic features of intron structure of rnl and cox1 of P. yezoensis at the intraspecific level, and found 12 genetic types from 40 culture strains from Korea and Japan (Tables 1 & 3).
The sequences of mitochondrial cox1 region have been recommended as DNA barcode markers to identify animal and algal species, and the cox1 region exhibited high efficiency in describing species boundaries (Hebert et al. 2003, Saunders 2005). In this study, five haplotypes of the cox1 gene were revealed for 40 P. yezoensis strains (Table 1). Korean P. yezoensis exhibited 4 haplotypes (haplotypes C1–C4) for 27 strains with 0.2–0.9% pairwise genetic distances. All the 13 Japanese P. yezoensis strains had the same cox1 sequence (haplotype C5), and showed 0.2–0.7% pairwise distances from the Korean haplotypes.
Some of the P. yezoensis strains yielded the same cox1 sequence, but different introns (Table 1). The most variable haplotype C3 of cox1 was sub-divided into nine genotypes (H1, H4, H5, H6, H7, H8, H9, H10, and H12), using the combined rnl and cox1. The genotype C1 was sub-divided into three genotypes (H1, H3, and H12). Therefore, the gene structure of the rnl and cox1 regions exhibited higher genetic resolution to discriminate P. yezoensis strains in comparison to the cox1 sequence variations in these samples.
Besides cox1 sequences, several genetic markers discriminating the Pyropia / Porphyra strains at the inter / intra-specific level, such as SSU ribosomal DNA (rDNA), ITS1, rbcL, and the RuBisCO spacer have been studied (Brodie et al. 1998, Lindstrom and Fredericq 2003, Hwang et al. 2005, Nelson et al. 2006, Niwa et al. 2009, Sutherland et al. 2011, Kucera and Saunders 2012, Mols-Mortensen et al. 2014, Guillemin et al. 2016). Nuclear SSU rDNA and rbcL sequences were shown to discriminate the Korean P. yezoensis strains from the Japanese P. yezoensis strains (Hwang et al. 2005). In this study, cox1 sequence analysis divided the 27 Korean P. yezoensis strains into four types; the presence / absence of introns in rnl and cox1 genes divided the 27 Korean P. yezoensis strains into 12 types; and the combination of both markers divided the Korean P. yezoensis strains into 14 types. These results implied that the combination of both markers was more useful in comparison to a single marker.
On the other hand, only one genotype was found in all the Japanese P. yezoensis strains, which was in contrast to the Korean strains. All Japanese P. yezoensis strains were aquaculture strains, except JP-Tu1. Niwa et al. (2008, 2009) reported the presence of three genotypes in 13 Japanese aquaculture strains of P. yezoensis; 11 strains had the same type, and each of the remaining two strains had a unique type based on ITS1 region analysis. The Japanese materials used in this study had only one genotype, which is the same type as that of P. yezoensis f. narawaensis reported by Niwa et al. (2008, 2009).
Theoretically, the presence / absence of introns can produce eight types in the rnl and 16 types in the cox1, and 128 types from the combination of rnl and cox1 of P. yezoensis. Additional genotypes of intron could be found across global samplings of P. yezoensis strains, including other Pyropia species in Korea, Japan, and China. In this study we found high intraspecific genetic variation in the rnl and cox1 genes, and showed that these two genes can better discriminate strains of P. yezoensis. These molecular markers can be useful to maintain the diversity of aquaculture strains and for the development of new cultivars.

SUPPLEMENTARY MATERIAL

Supplementary Fig. S1.
Electrophoresis gel images of the genotypes of rnl and cox1 from Pyropia yezoensis strains. Two PCR markers were also loaded in the gel (GeneRuler 1 kb DNA ladder [left; ThermoFisher Scientific, USA] and GeneRuler 100 bp Plus DNA ladder [middle]) (http://www.e-algae.org).
algae-2018-33-1-49-supple.pdf

ACKNOWLEDGEMENTS

This work was supported by a grant from the National Institute of Fisheries Science (R2018011 & P2018011), Korea.

Fig. 1
Gene structure of rnl (A) and cox1 (B) regions and the primer binding map. The exon / intron structures were re-analyzed using Hwang et al. (2013, 2014) as reference.
algae-2018-33-1-49f1.gif
Table 1
Details of the samples analyzed in this study
Species Strain code Genotype Sample site Sampling date

cox1 haplotype rnl and cox1 gene structure
Korean Pyropia yezoensis (27 strains) GB-1 C1 H1 R011C0100 Songdo, Pohang, Gyeongbuk Feb 6, 2001
GB-2 C2 H2a R101C1101 Masanri, Pohang, Gyeongbuk Apr 3, 2008
GN-1 C3 H1 R011C0100 Neungpo, Geoje, Gyeongnam Feb 5, 2001
GN-2 C1 H3 R010C0100 Galmok, Tongyeong, Gyeongnam Feb 7, 2001
GN-3 C1 H3 R010C0100 Sachon, Namhae, Gyeongnam Feb 29, 2004
JN-1 C3 H4 R110C0001 Cheongsando, Wando, Jeonnam Feb 19, 2004
JN-2 C3 H5 R111C0000 Maenggoldo, Jindo, Jeonnam Apr 1, 2007
JN-3 C3 H6 R101C0101 Hajodo, Jindo, Jeonnam Mar 19, 2004
JN-4 C3 H7 R111C0001 Euisin, Jindo, Jeonnam Feb 26, 2000
JN-5 C3 H5 R111C0000 Songji-1, Haenam, Jeonnam Feb 25, 2011
JN-6 C3 H5 R111C0000 Songji-2, Haenam, Jeonnam Mar 15, 2012
JN-7 C3 H5 R111C0000 Songji-3, Haenam, Jeonnam Feb 18, 2008
JN-8 C3 H8 R111C0101 Songji-4, Haenam, Jeonnam Feb 20, 2009
JN-9 C3 H5 R111C0000 Songji-5, Haenam, Jeonnam Feb 22, 2008
JN-10 C3 H5 R111C0000 Imhado-1, Haenam, Jeonnam Mar 10, 2014
JN-11 C3 H5 R111C0000 Imhado-2, Haenam, Jeonnam Mar 10, 2014
JN-12 C3 H9 R111C0100 Hwawon, Haenam, Jeonnam Mar 12, 2002
JN-13 C3 H5 R111C0000 Madong-1, Muan, Jeonnam Feb 27, 2013
JN-14 C3 H5 R111C0000 Madong-2, Muan, Jeonnam Feb 28, 2012
JN-15 C3 H12 R101C0111 Dochodo, Sinan, Jeonnam Mar 4, 2011
JN-16 C3 H12 R101C0111 Bigeumdo, Sinan, Jeonnam Mar 5, 2011
JN-17 C1 H12 R101C0111 Heuksando, Sinan, Jeonnam Jan 30, 2009
JB-1 C3 H10 R101C0100 Wido-1, Buan, Jeonbuk Apr 7, 2004
JB-2 C3 H10 R101C0100 Wido-2, Buan, Jeonbuk Apr 7, 2004
JB-3 C3 H8 R111C0101 Munyeodo, Gunsan, Jeonbuk Apr 8, 2004
CN-1 C4 H11 R110C0101 Daecheon-1, Chungnam Apr 22, 2004
CN-2 C4 H11 R110C0101 Daecheon-2, Chungnam Apr 22, 2004
Japanese P. yezoensis (13 strains) JP-Tu1 C5 H12 R101C0111 Tu-1, Kisarazu, Chiba, Japan Mar 9, 1974b
JP-PYN C5 H12 R101C0111 Aquaculture strain of P. yezoensis f. narawaensis from Japan 2000c
JP-PY1 C5 H12 R101C0111 Same as above 2004c
JP-PY2 C5 H12 R101C0111 Same as above 2004c
JP-PY3 C5 H12 R101C0111 Same as above 2004c
JP-PY4 C5 H12 R101C0111 Same as above 2008c
JP-PY5 C5 H12 R101C0111 Same as above 2008c
JP-PY6 C5 H12 R101C0111 Same as above 2007c
JP-PY7 C5 H12 R101C0111 Same as above 2007c
JP-PY8 C5 H12 R101C0111 Same as above 2007c
JP-PY9 C5 H12 R101C0111 Same as above 2007c
JP-PY10 C5 H12 R101C0111 Same as above 2007c
JP-PY11 C5 H12 R101C0111 Same as above 2007c

The structural variation of the gene is represented as a code (R = rnl, C = cox1, 0 = intron absent, 1 = intron present).

GenBank accession numbers for five types of cox1 sequences (C1–C5, MF663741-MF663745).

Electrophoresis gel images were represented in the Supplementary Fig. S1.

a H2 genotype showed the different length in introns.

b This sample was obtained from Prof. Saga in Hokkaido University, Japan.

c These were obtained from a company that cultures free living conchocelis filaments of Pyropia.

Table 2
Details of the primers used for the amplification of rnl and cox1 regions
Gene regiona Forward primer Sequence (5′ to 3′) Reverse primer Sequence (5′ to 3′)
rnl (e1)–(e2) rnle1Fpy1419F ACTCGGCAAATTTACTCCGTAC rnlRpp2 CATGATAAATCTGTTATCCCTAGAG
rnl (e2)–(e3) rnlFpp3 CCTCCTAAAGTGTAACGGAGGTG rnlRpp1 ACTGTCTCACGACGTTCTGAACC
rnl (e3)–(e4) rnlFpp2 GAACGTCGTGAGACAGTTCGGTC rnle4F197R GCAAGAAACAATACAACCGATACAC
cox1 (e1)–(e2) cox1e1Fpy1R CTCGACCAATCATAAAGATATAGG cox1e2Rpy46F AATACAGGATCGCCACCACC
cox1 (e2)–(e3) cox1e2Fpy68R TCAGGTGGTGGCGATCCTGT cox1e2Rpy1F ACCTATAGAAAGCATAGCATAAATC
cox1 (e3)–(e4) cox1e2Fpy1R ATGATTTATGCTATGCTTTCTATAGG cox1e3Rpt25448F AGCTAGTATAATACCAGTAAGTCC
cox1 (e4)–(e5) cox1e3Fpy1R TGGATTGCTACTATGTGAGAAGG cox1e5Rpy203F CTAAATAACGCAACATATGAACC

a We followed the results of Hwang et al. (2014) for nomenclature to present the structural variation.

Table 3
Primer position and the predicted amplicon size
Gene region PCR primer positiona Amplicon size (bp)


Primer Binding site Primer Binding site Intron (present) Intron (absent)
rnl (e1)–(e2) rnle1Fpy1419F 1,419–1,440 rnlRpp2 4,441–4,465 3,047 720
rnl (e2)–(e3) rnlFpp3 4,260–4,282 rnlRpp1 4,583–4,605 2,842b 346
rnl (e3)–(e4) rnlFpp2 4,589–4,611 rnle4F197R 7,174–7,198 2,610 120
cox1 (e1)–(e2) cox1e1Fpy1R 31,306–31,329 cox1e2Rpy46F 30,658–30,677 3,258c 672
cox1 (e2)–(e3) cox1e2Fpy68R 30,661–30,680 cox1e2Rpy1F 27,998–28,022 2,664 174
cox1 (e3)–(e4) cox1e2Fpy1R 27,999–28,024 cox1e3Rpt25448F 25,448–25,471 2,577 261
cox1 (e4)–(e5) cox1e3Fpy1R 25,536–25,558 cox1e5Rpy203F 22,773–22,795 2,786 425

PCR, polymerase chain reaction.

a The primer position and the predicted amplicon size was determined using the mitochondrial genome (mtDNA) of Pyropia yezoensis (NC_017837) as a reference.

b Pyropia yezoensis (KF561997, Hwang et al. 2014) was used as a reference, because P. yezoensis (NC_017837) does not have an intron between exon 2 (e2) and exon 3 (e3) of rnl gene (Hwang et al. 2014).

c Pyropia tenera (NC_021475) was used as a reference. Pyropia yezoensis (NC_01783, KF561997) does not have an intron between exon 1 (e1) and exon 2 (e2) of cox1 gene (Hwang et al. 2014).

REFERENCES

Bierne, N., Lehnert, SA., Bédier, E., Bonhomme, F. & Moore, SS. 2000. Screening for intron-length polymorphisms in penaeid shrimps using exon-primed intron-crossing (EPIC)-PCR. Mol Ecol. 9:233–235.
crossref
Brodie, J., Hayes, PK., Barker, GL., Irvine, LM. & Bartsch, I. 1998. A reappraisal of Porphyra and Bangia (Bangiophycidae, Rhodophyta) in the Northeast Atlantic based on the rbc L-rbc S intergenic spacer. J Phycol. 34:1069–1074.
crossref
Guillemin, ML., Contreras-Porcia, L., Ramírez, ME., Macaya, EC., Contador, CB., Woods, H., Wyatt, C. & Brodie, J. 2016. The bladed Bangiales (Rhodophyta) of the South Eastern Pacific: molecular species delimitation reveals extensive diversity. Mol Phylogenet Evol. 94:814–826.
crossref
Hebert, PDN., Cywinska, A., Ball, SL. & deWaard, JR. 2003. Biological identifications through DNA barcodes. Proc Biol Sci. 270:313–321.
crossref
Hughey, JR., Gabrielson, PW., Rohmer, L., Tortolani, J., Silva, M., Miller, KA., Young, JD., Martell, C. & Ruediger, E. 2014. Minimally destructive sampling of type specimens of Pyropia (Bangiales, Rhodophyta) recovers complete plastid and mitochondrial genomes. Sci Rep. 4:5113 pp.
crossref pdf
Hwang, MS., Kim, S-M., Ha, D-S., Baek, JM., Kim, H-S. & Choi, H-G. 2005. DNA sequences and identification of Porphyra cultivated by natural seeding on the southwest coast of Korea. Algae. 20:183–196.
crossref pdf
Hwang, MS., Kim, S-O., Ha, D-S., Lee, JE. & Lee, S-R. 2013. Complete sequence and genetic features of the mitochondrial genome of Pyropia tenera (Rhodophyta). Plant Biotechnol Rep. 7:435–443.
crossref
Hwang, MS., Kim, S-O., Ha, D-S., Lee, JE. & Lee, S-R. 2014. Complete mitochondrial genome sequence of Pyropia yezoensis (Bangiales, Rhodophyta) from Korea. Plant Biotechnol Rep. 8:221–227.
crossref
Ikuta, K., Kawai, H., Müller, DG. & Ohama, T. 2008. Recurrent invasion of mitochondrial group II introns in specimens of Pylaiella littoralis (brown alga), collected worldwide. Curr Genet. 53:207–216.
crossref
Kong, F., Sun, P., Cao, M., Wang, L. & Mao, Y. 2014. Complete mitochondrial genome of Pyropia yezoensis: reasserting the revision of genus Porphyra . Mitochondrial DNA. 25:335–336.
crossref
Kucera, H. & Saunders, GW. 2012. A survey of Bangiales (Rhodophyta) based on multiple molecular markers reveals cryptic diversity. J Phycol. 48:869–882.
crossref
Lindstrom, SC. & Fredericq, S. 2003. rbc L gene sequence reveal relationships among north-east Pacific species of Porphyra (Bangiales, Rhodophyta) and a new species, P aestivalis . Phycol Res. 51:211–224.
crossref
Mols-Mortensen, A., Neefus, CD., Pedersen, PM. & Brodie, J. 2014. Diversity and distribution of foliose Bangiales (Rhodophyta) in West Greenland: a link between the North Atlantic and North Pacific. Eur J Phycol. 49:1–10.
crossref
Nelson, WA., Farr, TJ. & Broom, JES. 2006. Phylogenetic relationships and generic concepts in the red order Bangiales: challenges ahead. Phycologia. 45:249–259.
crossref
Niwa, K., Iida, S., Kato, A., Kawai, H., Kikuchi, N., Kobiyama, A. & Aruga, Y. 2009. Genetic diversity and introgression in two cultivated species (Porphyra yezoensis and Porphyra tenera) and closely related wild species of Porphyra (Bangiales, Rhodophyta). J Phycol. 45:493–502.
crossref
Niwa, K., Kato, A., Kobiyama, A., Kawai, H. & Aruga, Y. 2008. Comparative study of wild and cultivated Porphyra yezoensis (Bangiales, Rhodophyta) based on molecular and morphological data. J Appl Phycol. 20:261–270.
crossref
Niwa, K., Kikuchi, N., Iwabuchi, M. & Aruga, Y. 2004. Morphological and AFLP variation of Porphyra yezoensis Ueda form, narawaensis Miura (Bangiales, Rhodophyta). Phycol Res. 52:180–190.

Niwa, K. & Kobiyama, A. 2009. Simple molecular discrimination of cultivated Porphyra species (Porphyra yezoensis and Porphyra tenera) and related wild species (Bangiales, Rhodophyta). Phycol Res. 57:299–303.
crossref
Niwa, K., Kobiyama, A. & Aruga, Y. 2005. Confirmation of cultivated Porphyra tenera (Bangiales, Rhodophyta) by polymerase chain reaction restriction fragment length polymorphism analyses of the plastid and nuclear DNA. Phycolo Res. 53:296–302.
crossref
Odintsova, MS. & Yurina, NP. 2002. The mitochondrial genome of protists. Russ J Genet. 38:642–655.
crossref
Palumbi, SR. & Baker, CS. 1994. Contrasting population structure from nuclear intron sequences and mtDNA of humpback whales. Mol Biol Evol. 11:426–435.

Park, E-J., Endo, H., Kitade, Y. & Saga, N. 2008. Simple differentiation of two closely related species Porphyra tenera and Porphyra yezoensis (Bangiophyceae, Rhodophyta) based on length polymorphism of actin-related protein 4 gene (ARP4). Fish Sci. 74:613–620.
crossref
Provasoli, L. 1968. Media and prospects for the cultivation of marine algae. In In : Watanabe, A & Hattori, A (Eds.) Culture and Collections of Algae. In: Proc US-Japan Conference, Japanese Society of Plant Physiology; Hakone. pp. 63–75.

Saunders, GW. 2005. Applying DNA barcoding to red macroalgae: a preliminary appraisal holds promise for future applications. Philos Trans R Soc Lond B Biol Sci. 360:1879–1888.
crossref
Smith, DR., Hua, J., Lee, RW. & Keeling, PJ. 2012. Relative rates of evolution among the three genetic compartments of the red alga Porphyra differ from those of green plants and do not correlate with genome architecture. Mol Phylogenet Evol. 65:339–344.
crossref
Sutherland, JE., Lindstrom, SC., Nelson, WA., Brodie, J., Lynch, MDJ., Hwang, MS., Choi, H-G., Miyata, M., Kikuchi, N., Oliveira, MC., Farr, T., Neefus, C., Mols-Mortensen, A., Milstein, D. & Müller, KM. 2011. A new look at an ancient order: generic revision of the Bangiales (Rhodophyta). J Phycol. 47:1131–1151.
crossref
Tamura, K., Stecher, G., Peterson, D., Filipski, A. & Kumar, S. 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol. 30:2725–2729.
crossref pdf
Yang, EC., Kim, KM., Kim, SY., Lee, J., Boo, GH., Lee, J-H., Nelson, WA., Yi, G., Schmidt, WE., Fredericq, S., Boo, SM., Bhattacharya, D. & Yoon, HS. 2015. Highly conserved mitochondrial genomes among multicellular red algae of the Florideophyceae. Genome Biol Evol. 7:2394–2406.
crossref pdf
TOOLS
PDF Links  PDF Links
PubReader  PubReader
ePub Link  ePub Link
Full text via DOI  Full text via DOI
Download Citation  Download Citation
Supplement Supplement1
  Print
Share:      
METRICS
9
Web of Science
9
Crossref
0
Scopus
9,344
View
213
Download
Related article
Effects of biostimulants, AMPEP and Kelpak on the growth and asexual reproduction of Pyropia yezoensis (Bangiales, Rhodophyta) at different temperatures  2024 March;39(1)
Editorial Office
[14348] A-1716, Gwangmyeong Trade Center, 72 Iljik-ro Gwangmyeong-si. Gyeonggi-do, Korea
Tel: +82-2-899-5980  Fax: +82-2-899-5922    E-mail: editalgae@gmail.com
About |  Browse Articles |  Current Issue |  For Authors and Reviewers
Copyright © The Korean Society of Phycology.                 Developed in M2PI